Abstract: Background: Toxoplasmosis is a globally prevalent zoonotic disease caused by the protozoan Toxoplasma gondii. This parasite infects warm-blooded animals, including sheep and humans. Consuming undercooked meat, particularly from free-range livestock like sheep, is strongly associated with human toxoplasmosis. In developing countries, at least 30% of the population tests positive for IgG antibodies against T. gondii. The infection is particularly concerning for pregnant women, as it can lead to serious damage to the fetus’s central nervous system, increasing the risk of congenital defects and abortion.

Methodology: A total of 1,062 tissue samples (252 livers, 74 lungs, 280 hearts, 254 brains, and 202 tongues) were randomly collected from 346 sheep (both rams and ewes) slaughtered in abattoirs in Nablus and Jenin. These tissues were examined for the presence of T. gondii DNA, extracted using the phenol-chloroform-isoamyl alcohol (PCI) method. The extracted DNA was tested for the TOX4/TOX5 genes, which are repeated 200-300 times, using Polymerase Chain Reaction (PCR) to visualize and analyze the forward (5′ CGCTGCAGGGAGAAGTTG3′) and reverse (5′ CGCTGCAGACACAGTGCATCTGGATT3′) amplicons.

Results: PCR results indicated that 25.72% (89/346) of the sheep were positive for T. gondii. The infection rate in Jenin was 19.27% (28/162), while in Nablus it was higher at 29.44% (53/180), with the highest infection rates observed in Nablus. The overall infection rates in heart, brain, liver, tongue, and lung tissues were 7.86% (22/280), 2.36% (6/254), 4.76% (12/252), 20.79% (44/202), and 21.78% (8/37) respectively. Among the 89 genotyped sheep, 16 had two infected tissues, with the tongue being one of the most frequently infected sites. The study confirmed the presence of T. gondii DNA in tissues of slaughtered sheep in the northern West Bank, with the highest infection rate found in the tongue. Additionally, ewes showed a higher infection rate compared to rams.

Conclusions: The high prevalence of toxoplasmosis in slaughtered animals, particularly in the tongue, underscores the risk of transmitting the parasite to humans through the consumption of undercooked meat. To mitigate this risk, it is crucial for people to avoid eating raw or undercooked meat, especially from infected sheep.

عنوان المؤتمر

International Conference of Medical Laboratory and Health SciencesResearch

دولة المؤتمر

الأردن

تاريخ المؤتمر

20 نوفمبر، 2024 - 22 نوفمبر، 2024

راعي المؤتمر

Accepted